This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 88 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
:D TYSM

abro1885

  • Member
  • Posts: 337
Reply 3 on: Yesterday
Excellent

« previous next »
 

Did you know?

The term bacteria was devised in the 19th century by German biologist Ferdinand Cohn. He based it on the Greek word "bakterion" meaning a small rod or staff. Cohn is considered to be the father of modern bacteriology.

Did you know?

The human body's pharmacokinetics are quite varied. Our hair holds onto drugs longer than our urine, blood, or saliva. For example, alcohol can be detected in the hair for up to 90 days after it was consumed. The same is true for marijuana, cocaine, ecstasy, heroin, methamphetamine, and nicotine.

Did you know?

Not getting enough sleep can greatly weaken the immune system. Lack of sleep makes you more likely to catch a cold, or more difficult to fight off an infection.

Did you know?

Stroke kills people from all ethnic backgrounds, but the people at highest risk for fatal strokes are: black men, black women, Asian men, white men, and white women.

Did you know?

Approximately 25% of all reported medication errors result from some kind of name confusion.

The Serial Reaction Time Task The Serial Reaction Time Task
a) Type IV hypersensitivity reaction, contact dermatitis as the result of reaction to the nickel in ... a) Type IV hypersensitivity reaction, contact dermatitis as the result of reaction to the nickel in ...
Extension of telomeric DNA by telomerase: The overall reaction Extension of telomeric DNA by telomerase: The overall reaction
How many grams of H2 gas can be produced by the reaction of 54.0 grams of Al(s) with an excess ... How many grams of H2 gas can be produced by the reaction of 54.0 grams of Al(s) with an excess ...
How much energy is required to form 141.8 g of Cl2, according to the reaction below? The molar ... How much energy is required to form 141.8 g of Cl2, according to the reaction below? The molar ...
A chemical reaction is run in which 447 Joules of work is done by the system and A chemical reaction is run in which 447 Joules of work is done by the system and
Video: Phlebotomy

For a complete list of videos, visit our video library