This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 80 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
:D TYSM

kilada

  • Member
  • Posts: 311
Reply 3 on: Yesterday
Wow, this really help

« previous next »
 

Did you know?

Most strokes are caused when blood clots move to a blood vessel in the brain and block blood flow to that area. Thrombolytic therapy can be used to dissolve the clot quickly. If given within 3 hours of the first stroke symptoms, this therapy can help limit stroke damage and disability.

Did you know?

The immune system needs 9.5 hours of sleep in total darkness to recharge completely.

Did you know?

All adverse reactions are commonly charted in red ink in the patient's record and usually are noted on the front of the chart. Failure to follow correct documentation procedures may result in malpractice lawsuits.

Did you know?

Recent studies have shown that the number of medication errors increases in relation to the number of orders that are verified per pharmacist, per work shift.

Did you know?

Vaccines cause herd immunity. If the majority of people in a community have been vaccinated against a disease, an unvaccinated person is less likely to get the disease since others are less likely to become sick from it and spread the disease.

The steps of an enzyme-catalyzed reaction The steps of an enzyme-catalyzed reaction
Influence of enzyme-substrate affinity on the rate of an enzyme-catalyzed reaction. Influence of enzyme-substrate affinity on the rate of an enzyme-catalyzed reaction.
Reaction limited by substrate concentration Reaction limited by substrate concentration
Simple amplification of 1kb DNA fragments by polymerase chain reaction. Simple amplification of 1kb DNA fragments by polymerase chain reaction.
Cholesterol reaction Cholesterol reaction
Very nice definition of time Very nice definition of time
Video: Cardiac Cycle (Part 1 of 4)

For a complete list of videos, visit our video library