This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 43 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
YES! Correct, THANKS for helping me on my review

elyse44

  • Member
  • Posts: 319
Reply 3 on: Yesterday
Excellent

« previous next »
 

Did you know?

There are over 65,000 known species of protozoa. About 10,000 species are parasitic.

Did you know?

The human body's pharmacokinetics are quite varied. Our hair holds onto drugs longer than our urine, blood, or saliva. For example, alcohol can be detected in the hair for up to 90 days after it was consumed. The same is true for marijuana, cocaine, ecstasy, heroin, methamphetamine, and nicotine.

Did you know?

Patients who have undergone chemotherapy for the treatment of cancer often complain of a lack of mental focus; memory loss; and a general diminution in abilities such as multitasking, attention span, and general mental agility.

Did you know?

Adolescents often feel clumsy during puberty because during this time of development, their hands and feet grow faster than their arms and legs do. The body is therefore out of proportion. One out of five adolescents actually experiences growing pains during this period.

Did you know?

Recent studies have shown that the number of medication errors increases in relation to the number of orders that are verified per pharmacist, per work shift.

Exergonic/Endergonic Reactions Exergonic/Endergonic Reactions
The reaction of a PLP-dependent decarboxylation to yield serotonin The reaction of a PLP-dependent decarboxylation to yield serotonin
Serine and glycine are closely interconnected via the serine hydroxymethyltransferase reaction Serine and glycine are closely interconnected via the serine hydroxymethyltransferase reaction
What is the value for Kc for the following reaction: PbCl2(s) ⇌ Pb2+(aq) + 2 Cl-(aq), if ... What is the value for Kc for the following reaction: PbCl2(s) ⇌ Pb2+(aq) + 2 Cl-(aq), if ...
What is the definition of reticulate speciation? What is the definition of reticulate speciation?
Witting Reaction Witting Reaction
Video: Introduction to Macular Degeneration

For a complete list of videos, visit our video library