This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 73 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Wow, this really help

debra928

  • Member
  • Posts: 342
Reply 3 on: Yesterday
YES! Correct, THANKS for helping me on my review

« previous next »
 

Did you know?

HIV testing reach is still limited. An estimated 40% of people with HIV (more than 14 million) remain undiagnosed and do not know their infection status.

Did you know?

Egg cells are about the size of a grain of sand. They are formed inside of a female's ovaries before she is even born.

Did you know?

Serum cholesterol testing in adults is recommended every 1 to 5 years. People with diabetes and a family history of high cholesterol should be tested even more frequently.

Did you know?

Famous people who died from poisoning or drug overdose include, Adolf Hitler, Socrates, Juan Ponce de Leon, Marilyn Monroe, Judy Garland, and John Belushi.

Did you know?

In 2012, nearly 24 milliion Americans, aged 12 and older, had abused an illicit drug, according to the National Institute on Drug Abuse (NIDA).

Exergonic/Endergonic Reactions Exergonic/Endergonic Reactions
pupil light reaction pupil light reaction
Simple amplification of 1kb DNA fragments by polymerase chain reaction. Simple amplification of 1kb DNA fragments by polymerase chain reaction.
Reaction coordinate diagram for a simple enzyme catalyzed reaction Reaction coordinate diagram for a simple enzyme catalyzed reaction
Mechanism of the two-component molybdenum-dependent nitrogenase reaction Mechanism of the two-component molybdenum-dependent nitrogenase reaction
What is the value for Kc for this reaction at 25°C? What is the value for Kc for this reaction at 25°C?
Video: Hormonal feedback loop components

For a complete list of videos, visit our video library