This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 57 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Thanks for the timely response, appreciate it

juliaf

  • Member
  • Posts: 344
Reply 3 on: Yesterday
Great answer, keep it coming :)

« previous next »
 

Did you know?

In the United States, there is a birth every 8 seconds, according to the U.S. Census Bureau's Population Clock.

Did you know?

The first oncogene was discovered in 1970 and was termed SRC (pronounced "SARK").

Did you know?

As many as 20% of Americans have been infected by the fungus known as Histoplasmosis. While most people are asymptomatic or only have slight symptoms, infection can progress to a rapid and potentially fatal superinfection.

Did you know?

According to animal studies, the typical American diet is damaging to the liver and may result in allergies, low energy, digestive problems, and a lack of ability to detoxify harmful substances.

Did you know?

The familiar sounds of your heart are made by the heart's valves as they open and close.

reaction system of photosynthesis reaction system of photosynthesis
The hydrolysis of an amide bond, shown here, is the same reaction The hydrolysis of an amide bond, shown here, is the same reaction
Model of a purple bacterial reaction center complex Model of a purple bacterial reaction center complex
Mechanism of the biotin-dependent pyruvate carboxylase reaction Phase I Mechanism of the biotin-dependent pyruvate carboxylase reaction Phase I
If 250. L of nitrogen reacts with 582 L of hydrogen by the reaction: N2(g) + 3 H2(g) 2 NH3(g), ... If 250. L of nitrogen reacts with 582 L of hydrogen by the reaction: N2(g) + 3 H2(g) 2 NH3(g), ...
For a particular cell based on the reaction:3 AgCl(s) + Al(s) → 3 Ag(s) + Al3+(aq) + 3 ... For a particular cell based on the reaction:3 AgCl(s) + Al(s) → 3 Ag(s) + Al3+(aq) + 3 ...
Video: Biological organic compounds

For a complete list of videos, visit our video library