This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 87 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Gracias!

  • Member
  • Posts:
Reply 3 on: Yesterday
Thanks for the timely response, appreciate it

« previous next »
 

Did you know?

The horizontal fraction bar was introduced by the Arabs.

Did you know?

The calories found in one piece of cherry cheesecake could light a 60-watt light bulb for 1.5 hours.

Did you know?

Despite claims by manufacturers, the supplement known as Ginkgo biloba was shown in a study of more than 3,000 participants to be ineffective in reducing development of dementia and Alzheimer’s disease in older people.

Did you know?

Amphetamine poisoning can cause intravascular coagulation, circulatory collapse, rhabdomyolysis, ischemic colitis, acute psychosis, hyperthermia, respiratory distress syndrome, and pericarditis.

Did you know?

Common abbreviations that cause medication errors include U (unit), mg (milligram), QD (every day), SC (subcutaneous), TIW (three times per week), D/C (discharge or discontinue), HS (at bedtime or "hours of sleep"), cc (cubic centimeters), and AU (each ear).

The patient is undergoing an allergy skin test by receiving subdermal inoculations of allergens. Inf The patient is undergoing an allergy skin test by receiving subdermal inoculations of allergens. Inf
Principles of amplification of selected fragments of DNA by polymerase chain reaction cycling. Principles of amplification of selected fragments of DNA by polymerase chain reaction cycling.
Simple amplification of 1kb DNA fragments by polymerase chain reaction. Simple amplification of 1kb DNA fragments by polymerase chain reaction.
Reaction coordinate diagram for a simple enzyme catalyzed reaction Reaction coordinate diagram for a simple enzyme catalyzed reaction
Reaction mechansim for glyceraldehyde-3-phosphate dehydrogenase Reaction mechansim for glyceraldehyde-3-phosphate dehydrogenase
What is the value for Kc for the following reaction: PbCl2(s) ⇌ Pb2+(aq) + 2 Cl-(aq), if ... What is the value for Kc for the following reaction: PbCl2(s) ⇌ Pb2+(aq) + 2 Cl-(aq), if ...
Video: Transferring genes into plants Animation

For a complete list of videos, visit our video library