This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 41 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Great answer, keep it coming :)

fatboyy09

  • Member
  • Posts: 358
Reply 3 on: Yesterday
Excellent

« previous next »
 

Did you know?

In the United States, congenital cytomegalovirus causes one child to become disabled almost every hour. CMV is the leading preventable viral cause of development disability in newborns. These disabilities include hearing or vision loss, and cerebral palsy.

Did you know?

Pink eye is a term that refers to conjunctivitis, which is inflammation of the thin, clear membrane (conjunctiva) over the white part of the eye (sclera). It may be triggered by a virus, bacteria, or foreign body in the eye. Antibiotic eye drops alleviate bacterial conjunctivitis, and antihistamine allergy pills or eye drops help control allergic conjunctivitis symptoms.

Did you know?

ACTH levels are normally highest in the early morning (between 6 and 8 A.M.) and lowest in the evening (between 6 and 11 P.M.). Therefore, a doctor who suspects abnormal levels looks for low ACTH in the morning and high ACTH in the evening.

Did you know?

About one in five American adults and teenagers have had a genital herpes infection—and most of them don't know it. People with genital herpes have at least twice the risk of becoming infected with HIV if exposed to it than those people who do not have genital herpes.

Did you know?

The most destructive flu epidemic of all times in recorded history occurred in 1918, with approximately 20 million deaths worldwide.

Methane combustion as an energy–yielding redox reaction. Methane combustion as an energy–yielding redox reaction.
The Mantoux tuberculin skin test. Positive reaction. The Mantoux tuberculin skin test. Positive reaction.
Reaction 1: The First ATP Investment Reaction 1: The First ATP Investment
How much energy is required to form 141.8 g of Cl2, according to the reaction below? The molar ... How much energy is required to form 141.8 g of Cl2, according to the reaction below? The molar ...
The chemical reaction catalyzed by DNA polymerase I The chemical reaction catalyzed by DNA polymerase I
Endergonic and Exergonic Reactions Endergonic and Exergonic Reactions
Video: Pneumonia Animation

For a complete list of videos, visit our video library