This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 78 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Excellent

okolip

  • Member
  • Posts: 362
Reply 3 on: Yesterday
Thanks for the timely response, appreciate it

« previous next »
 

Did you know?

Blastomycosis is often misdiagnosed, resulting in tragic outcomes. It is caused by a fungus living in moist soil, in wooded areas of the United States and Canada. If inhaled, the fungus can cause mild breathing problems that may worsen and cause serious illness and even death.

Did you know?

Between 1999 and 2012, American adults with high total cholesterol decreased from 18.3% to 12.9%

Did you know?

The people with the highest levels of LDL are Mexican American males and non-Hispanic black females.

Did you know?

As of mid-2016, 18.2 million people were receiving advanced retroviral therapy (ART) worldwide. This represents between 43–50% of the 34–39.8 million people living with HIV.

Did you know?

All adults should have their cholesterol levels checked once every 5 years. During 2009–2010, 69.4% of Americans age 20 and older reported having their cholesterol checked within the last five years.

allergic reaction allergic reaction
Redox Reaction Redox Reaction
A latex agglutination reaction. This is an analysis for rheumatoid factor. Immunoglobulin is bound ... A latex agglutination reaction. This is an analysis for rheumatoid factor. Immunoglobulin is bound ...
Principles of amplification of selected fragments of DNA by polymerase chain reaction cycling. Principles of amplification of selected fragments of DNA by polymerase chain reaction cycling.
A phosphoribosyltransferase reaction A phosphoribosyltransferase reaction
Bowen’s Reaction Series Bowen’s Reaction Series
Video: Negative Feedback Regulation of Blood Pressure

For a complete list of videos, visit our video library