This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 72 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Excellent

peter

  • Member
  • Posts: 330
Reply 3 on: Yesterday
Thanks for the timely response, appreciate it

« previous next »
 

Did you know?

The eye muscles are the most active muscles in the whole body. The external muscles that move the eyes are the strongest muscles in the human body for the job they have to do. They are 100 times more powerful than they need to be.

Did you know?

A seasonal flu vaccine is the best way to reduce the chances you will get seasonal influenza and spread it to others.

Did you know?

The first war in which wide-scale use of anesthetics occurred was the Civil War, and 80% of all wounds were in the extremities.

Did you know?

Alcohol acts as a diuretic. Eight ounces of water is needed to metabolize just 1 ounce of alcohol.

Did you know?

Fatal fungal infections may be able to resist newer antifungal drugs. Globally, fungal infections are often fatal due to the lack of access to multiple antifungals, which may be required to be utilized in combination. Single antifungals may not be enough to stop a fungal infection from causing the death of a patient.

Effect of substrate concentration on the initial velocity of an enzyme-catalyzed reaction Effect of substrate concentration on the initial velocity of an enzyme-catalyzed reaction
Changes in the free energy (DG) of exergonic and endergonic reactions Changes in the free energy (DG) of exergonic and endergonic reactions
Formation of a polynucleotide by a hypothetical dehydration reaction Formation of a polynucleotide by a hypothetical dehydration reaction
Isomerization reaction proceeds via an enediolate intermediate. Isomerization reaction proceeds via an enediolate intermediate.
Witting Reaction Witting Reaction
The reaction catalyzed by the enzyme polynucleotide phosphorylase The reaction catalyzed by the enzyme polynucleotide phosphorylase
Video: Semidiscontinuous DNA replication

For a complete list of videos, visit our video library