This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 68 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Gracias!

Animal_Goddess

  • Member
  • Posts: 339
Reply 3 on: Yesterday
Thanks for the timely response, appreciate it

« previous next »
 

Did you know?

Lower drug doses for elderly patients should be used first, with titrations of the dose as tolerated to prevent unwanted drug-related pharmacodynamic effects.

Did you know?

Elderly adults are living longer, and causes of death are shifting. At the same time, autopsy rates are at or near their lowest in history.

Did you know?

Individuals are never “cured” of addictions. Instead, they learn how to manage their disease to lead healthy, balanced lives.

Did you know?

Aspirin may benefit 11 different cancers, including those of the colon, pancreas, lungs, prostate, breasts, and leukemia.

Did you know?

Acute bronchitis is an inflammation of the breathing tubes (bronchi), which causes increased mucus production and other changes. It is usually caused by bacteria or viruses, can be serious in people who have pulmonary or cardiac diseases, and can lead to pneumonia.

Reaction against infection Reaction against infection
Time dependence of the rates of a chemical reaction Time dependence of the rates of a chemical reaction
(c) A photograph of a hemagglutination reaction. In the tube labeled 0, there is no agglutination, ... (c) A photograph of a hemagglutination reaction. In the tube labeled 0, there is no agglutination, ...
Reaction at constant-pressure Reaction at constant-pressure
Reaction mechanism for fructose-1,6-bisphosphate aldolase Reaction mechanism for fructose-1,6-bisphosphate aldolase
The reaction catalyzed by DNA ligase The reaction catalyzed by DNA ligase
Video: Mechanisms of capillary exchange (transcytosis & bulk flow)

For a complete list of videos, visit our video library