This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 42 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Great answer, keep it coming :)

alexanderhamilton

  • Member
  • Posts: 334
Reply 3 on: Yesterday
Wow, this really help

« previous next »
 

Did you know?

Oliver Wendell Holmes is credited with introducing the words "anesthesia" and "anesthetic" into the English language in 1846.

Did you know?

According to animal studies, the typical American diet is damaging to the liver and may result in allergies, low energy, digestive problems, and a lack of ability to detoxify harmful substances.

Did you know?

On average, the stomach produces 2 L of hydrochloric acid per day.

Did you know?

Anti-aging claims should not ever be believed. There is no supplement, medication, or any other substance that has been proven to slow or stop the aging process.

Did you know?

The first successful kidney transplant was performed in 1954 and occurred in Boston. A kidney from an identical twin was transplanted into his dying brother's body and was not rejected because it did not appear foreign to his body.

The norm of reaction The norm of reaction
Blood-typing and cross-reactions: The blood type depends on the presence of surface antigens (agglut Blood-typing and cross-reactions: The blood type depends on the presence of surface antigens (agglut
The cross-linking reaction in peptidoglycan synthesis (left) and inhibition of the transpeptidase The cross-linking reaction in peptidoglycan synthesis (left) and inhibition of the transpeptidase
The overall reaction catalyzed by the NADH dehydrogenase complex The overall reaction catalyzed by the NADH dehydrogenase complex
Bowen’s Reaction Series Bowen’s Reaction Series
How the cortical reaction in a mouse egg is thought to prevent additional sperm from entering the eg How the cortical reaction in a mouse egg is thought to prevent additional sperm from entering the eg
Video: Dietary Cholesterol & LDL

For a complete list of videos, visit our video library