This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 56 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Thanks for the timely response, appreciate it

jackie

  • Member
  • Posts: 324
Reply 3 on: Yesterday
YES! Correct, THANKS for helping me on my review

« previous next »
 

Did you know?

Most strokes are caused when blood clots move to a blood vessel in the brain and block blood flow to that area. Thrombolytic therapy can be used to dissolve the clot quickly. If given within 3 hours of the first stroke symptoms, this therapy can help limit stroke damage and disability.

Did you know?

The lipid bilayer is made of phospholipids. They are arranged in a double layer because one of their ends is attracted to water while the other is repelled by water.

Did you know?

Amoebae are the simplest type of protozoans, and are characterized by a feeding and dividing trophozoite stage that moves by temporary extensions called pseudopodia or false feet.

Did you know?

Autoimmune diseases occur when the immune system destroys its own healthy tissues. When this occurs, white blood cells cannot distinguish between pathogens and normal cells.

Did you know?

The most destructive flu epidemic of all times in recorded history occurred in 1918, with approximately 20 million deaths worldwide.

Fluidization - Reaction Rate Chart Fluidization - Reaction Rate Chart
Reaction 3: The Second Investment of ATP Reaction 3: The Second Investment of ATP
Reaction 7: The First Substrate-Level Phosphorylation Reaction 7: The First Substrate-Level Phosphorylation
How to find the reaction for each of the beams below. How to find the reaction for each of the beams below.
How much energy is required to form 141.8 g of Cl2, according to the reaction below? The molar ... How much energy is required to form 141.8 g of Cl2, according to the reaction below? The molar ...
What is the value for Kp for this reaction? What is the value for Kp for this reaction?
Video: Semidiscontinuous DNA replication

For a complete list of videos, visit our video library