This topic contains a solution. Click here to go to the answer

Author Question: By definition, exergonic reaction has: (Read 85 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly




nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Excellent


smrtceo

  • Member
  • Posts: 344
Reply 3 on: Yesterday
:D TYSM

 

Did you know?

Methicillin-resistant Staphylococcus aureus or MRSA was discovered in 1961 in the United Kingdom. It if often referred to as a superbug. MRSA infections cause more deaths in the United States every year than AIDS.

Methicilli ...
Did you know?

Medication errors are three times higher among children and infants than with adults.

Did you know?

Atropine, along with scopolamine and hyoscyamine, is found in the Datura stramonium plant, which gives hallucinogenic effects and is also known as locoweed.

Did you know?

The lipid bilayer is made of phospholipids. They are arranged in a double layer because one of their ends is attracted to water while the other is repelled by water.

Did you know?

Carbamazepine can interfere with the results of home pregnancy tests. If you are taking carbamazepine, do not try to test for pregnancy at home.

For a complete list of videos, visit our video library