This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 86 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Great answer, keep it coming :)

mcarey591

  • Member
  • Posts: 365
Reply 3 on: Yesterday
Excellent

« previous next »
 

Did you know?

Not getting enough sleep can greatly weaken the immune system. Lack of sleep makes you more likely to catch a cold, or more difficult to fight off an infection.

Did you know?

A cataract is a clouding of the eyes' natural lens. As we age, some clouding of the lens may occur. The first sign of a cataract is usually blurry vision. Although glasses and other visual aids may at first help a person with cataracts, surgery may become inevitable. Cataract surgery is very successful in restoring vision, and it is the most frequently performed surgery in the United States.

Did you know?

Malaria was not eliminated in the United States until 1951. The term eliminated means that no new cases arise in a country for 3 years.

Did you know?

In inpatient settings, adverse drug events account for an estimated one in three of all hospital adverse events. They affect approximately 2 million hospital stays every year, and prolong hospital stays by between one and five days.

Did you know?

The most common treatment options for addiction include psychotherapy, support groups, and individual counseling.

Reaction coordinate diagram comparing enzyme-catalyzed and uncatalyzed reactions Reaction coordinate diagram comparing enzyme-catalyzed and uncatalyzed reactions
Reaction 1: The First ATP Investment Reaction 1: The First ATP Investment
The overall reaction catalyzed by the NADH dehydrogenase complex The overall reaction catalyzed by the NADH dehydrogenase complex
Serine and glycine are closely interconnected via the serine hydroxymethyltransferase reaction Serine and glycine are closely interconnected via the serine hydroxymethyltransferase reaction
The reaction catalyzed by DNA ligase The reaction catalyzed by DNA ligase
In the reaction C(s) + O2(g) CO2(g) carbon is __________. In the reaction C(s) + O2(g) CO2(g) carbon is __________.
Video: Apicomplexan life cycle Animation

For a complete list of videos, visit our video library