This topic contains a solution. Click here to go to the answer

Author Question: By definition, exergonic reaction has: (Read 81 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly




nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Excellent


debra928

  • Member
  • Posts: 342
Reply 3 on: Yesterday
:D TYSM

 

Did you know?

It is difficult to obtain enough calcium without consuming milk or other dairy foods.

Did you know?

There are over 65,000 known species of protozoa. About 10,000 species are parasitic.

Did you know?

Human stomach acid is strong enough to dissolve small pieces of metal such as razor blades or staples.

Did you know?

Alzheimer's disease affects only about 10% of people older than 65 years of age. Most forms of decreased mental function and dementia are caused by disuse (letting the mind get lazy).

Did you know?

Disorders that may affect pharmacodynamics include genetic mutations, malnutrition, thyrotoxicosis, myasthenia gravis, Parkinson's disease, and certain forms of insulin-resistant diabetes mellitus.

For a complete list of videos, visit our video library