This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 89 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
:D TYSM

phuda

  • Member
  • Posts: 348
Reply 3 on: Yesterday
Thanks for the timely response, appreciate it

« previous next »
 

Did you know?

The shortest mature adult human of whom there is independent evidence was Gul Mohammed in India. In 1990, he was measured in New Delhi and stood 22.5 inches tall.

Did you know?

The Babylonians wrote numbers in a system that used 60 as the base value rather than the number 10. They did not have a symbol for "zero."

Did you know?

No drugs are available to relieve parathyroid disease. Parathyroid disease is caused by a parathyroid tumor, and it needs to be removed by surgery.

Did you know?

The Centers for Disease Control and Prevention has released reports detailing the deaths of infants (younger than 1 year of age) who died after being given cold and cough medications. This underscores the importance of educating parents that children younger than 2 years of age should never be given over-the-counter cold and cough medications without consulting their physicians.

Did you know?

Aspirin may benefit 11 different cancers, including those of the colon, pancreas, lungs, prostate, breasts, and leukemia.

Polymerase chain reaction (PCR) Polymerase chain reaction (PCR)
allergic reaction allergic reaction
The explosion of the Maine in Havana harbor, killing 260 men, caused much speculation in the newspap The explosion of the Maine in Havana harbor, killing 260 men, caused much speculation in the newspap
Reaction at constant-volume Reaction at constant-volume
Reaction at constant-pressure Reaction at constant-pressure
What is the value for Kp for this reaction? What is the value for Kp for this reaction?
Video: Requirements for nervous signals

For a complete list of videos, visit our video library