This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 48 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
YES! Correct, THANKS for helping me on my review

bulacsom

  • Member
  • Posts: 329
Reply 3 on: Yesterday
Wow, this really help

« previous next »
 

Did you know?

In women, pharmacodynamic differences include increased sensitivity to (and increased effectiveness of) beta-blockers, opioids, selective serotonin reuptake inhibitors, and typical antipsychotics.

Did you know?

Atropine, along with scopolamine and hyoscyamine, is found in the Datura stramonium plant, which gives hallucinogenic effects and is also known as locoweed.

Did you know?

The modern decimal position system was the invention of the Hindus (around 800 AD), involving the placing of numerals to indicate their value (units, tens, hundreds, and so on).

Did you know?

Eating food that has been cooked with poppy seeds may cause you to fail a drug screening test, because the seeds contain enough opiate alkaloids to register as a positive.

Did you know?

Addicts to opiates often avoid treatment because they are afraid of withdrawal. Though unpleasant, with proper management, withdrawal is rarely fatal and passes relatively quickly.

(c) A photograph of a hemagglutination reaction. In the tube labeled 0, there is no agglutination, ... (c) A photograph of a hemagglutination reaction. In the tube labeled 0, there is no agglutination, ...
Reaction at constant-volume Reaction at constant-volume
Carbonyl groups reaction type Carbonyl groups reaction type
Reaction 2: Isomerization of Glucose-6-phosphate Reaction 2: Isomerization of Glucose-6-phosphate
Reaction 1: The Initial Dehydrogenation Reaction 1: The Initial Dehydrogenation
The glutamine synthetase reaction occurs via an acyl phosphate intermediate The glutamine synthetase reaction occurs via an acyl phosphate intermediate
Video: Heart Chambers

For a complete list of videos, visit our video library