This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: By definition, exergonic reaction has: (Read 44 times)

nenivikky

  • Hero Member
  • *****
  • Posts: 516
on: Jul 8, 2021

Question 1

Below is a single stranded DNA sequence from an unwound chromosome that is in the process of replication. What would be the sequence of the complementary DNA strand produced during the replication of this strand?

ATTGCGCTTATTCGCGTTAAAGGCCTCTGATG

◦ GCCATATCCGCCTATACCGGGAATTCTCAGCA
◦ CGGTATAGGCGGATATGGCCCTTAAGAGTCGT
◦ ACCTGTGTTAAGTGTACGTAAAGCTAATGGGT
◦ TAAGCGCAATAACGCGAATTTCCGGAGAGTAG
◦ TAACGCGAATAAGCGCAATTTCCGGAGACTAC

Question 2

By definition, exergonic reaction has:
◦ ΔG= positive value
◦ ΔG= negative value
◦ ΔH= positive value
◦ ΔH= negative value
◦ ΔS= positive value
General Chemistry: Principles and Modern Applications ¦ Petrucci, Herring, Madura, Bissonnette ¦ 11th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by nenivikky on Jul 8, 2021

mcomstock09

  • Sr. Member
  • ****
  • Posts: 377
Reply #1 on: Jul 8, 2021
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 32% of students answer this correctly


nenivikky

  • Member
  • Posts: 516
Reply 2 on: Jul 8, 2021
Gracias!

bimper21

  • Member
  • Posts: 309
Reply 3 on: Yesterday
Great answer, keep it coming :)

« previous next »
 

Did you know?

A cataract is a clouding of the eyes' natural lens. As we age, some clouding of the lens may occur. The first sign of a cataract is usually blurry vision. Although glasses and other visual aids may at first help a person with cataracts, surgery may become inevitable. Cataract surgery is very successful in restoring vision, and it is the most frequently performed surgery in the United States.

Did you know?

More than 150,000 Americans killed by cardiovascular disease are younger than the age of 65 years.

Did you know?

Egg cells are about the size of a grain of sand. They are formed inside of a female's ovaries before she is even born.

Did you know?

Serum cholesterol testing in adults is recommended every 1 to 5 years. People with diabetes and a family history of high cholesterol should be tested even more frequently.

Did you know?

Glaucoma is a leading cause of blindness. As of yet, there is no cure. Everyone is at risk, and there may be no warning signs. It is six to eight times more common in African Americans than in whites. The best and most effective way to detect glaucoma is to receive a dilated eye examination.

(c) A photograph of a hemagglutination reaction. In the tube labeled 0, there is no agglutination, ... (c) A photograph of a hemagglutination reaction. In the tube labeled 0, there is no agglutination, ...
The cross-linking reaction in peptidoglycan synthesis (left) and inhibition of the transpeptidase The cross-linking reaction in peptidoglycan synthesis (left) and inhibition of the transpeptidase
Reaction 1: The First ATP Investment Reaction 1: The First ATP Investment
Glutathione reaction with compound (denoted RX) Glutathione reaction with compound (denoted RX)
How to find the reaction for each of the beams below. How to find the reaction for each of the beams below.
Problem Solving – Energy Changes in Chemical Reaction Problem Solving – Energy Changes in Chemical Reaction
Video: Helper T cell receptors, activation, proliferation, differentiation & action

For a complete list of videos, visit our video library