This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 102 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

ACTH levels are normally highest in the early morning (between 6 and 8 A.M.) and lowest in the evening (between 6 and 11 P.M.). Therefore, a doctor who suspects abnormal levels looks for low ACTH in the morning and high ACTH in the evening.

Did you know?

There are major differences in the metabolism of morphine and the illegal drug heroin. Morphine mostly produces its CNS effects through m-receptors, and at k- and d-receptors. Heroin has a slight affinity for opiate receptors. Most of its actions are due to metabolism to active metabolites (6-acetylmorphine, morphine, and morphine-6-glucuronide).

Did you know?

The types of cancer that alpha interferons are used to treat include hairy cell leukemia, melanoma, follicular non-Hodgkin's lymphoma, and AIDS-related Kaposi's sarcoma.

Did you know?

In inpatient settings, adverse drug events account for an estimated one in three of all hospital adverse events. They affect approximately 2 million hospital stays every year, and prolong hospital stays by between one and five days.

Did you know?

Immunoglobulin injections may give short-term protection against, or reduce severity of certain diseases. They help people who have an inherited problem making their own antibodies, or those who are having certain types of cancer treatments.

Sandwich or capture enzyme immunoassay for patient IgM (double capture: IgM capture, Ag capture). Sandwich or capture enzyme immunoassay for patient IgM (double capture: IgM capture, Ag capture).
Dipole interaction of E. coli enzyme structure Dipole interaction of E. coli enzyme structure
An Enzyme in Action Enzymes speed up reactions in your body An Enzyme in Action Enzymes speed up reactions in your body
8.The following table contains DNA-sequence information compiled by Marilyn Kozak (1987). The ... 8.The following table contains DNA-sequence information compiled by Marilyn Kozak (1987). The ...
Constructing a restriction map (2 of 5) Constructing a restriction map (2 of 5)
Enzyme activity varies with temperature Enzyme activity varies with temperature
Video: Mendel's Principles of Dominance, Segregation and Independent Assortment

For a complete list of videos, visit our video library