This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 54 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

Calcitonin is a naturally occurring hormone. In women who are at least 5 years beyond menopause, it slows bone loss and increases spinal bone density.

Did you know?

Certain topical medications such as clotrimazole and betamethasone are not approved for use in children younger than 12 years of age. They must be used very cautiously, as directed by a doctor, to treat any child. Children have a much greater response to topical steroid medications.

Did you know?

There are 20 feet of blood vessels in each square inch of human skin.

Did you know?

The training of an anesthesiologist typically requires four years of college, 4 years of medical school, 1 year of internship, and 3 years of residency.

Did you know?

In ancient Rome, many of the richer people in the population had lead-induced gout. The reason for this is unclear. Lead poisoning has also been linked to madness.

Release of ordered water favors formation of an enzyme-substrate complex Release of ordered water favors formation of an enzyme-substrate complex
Induced-fit model of enzyme activity. Induced-fit model of enzyme activity.
Sequence homology between myoglobin in humans vs. whales Sequence homology between myoglobin in humans vs. whales
Reaction coordinate diagram for a simple enzyme catalyzed reaction Reaction coordinate diagram for a simple enzyme catalyzed reaction
Enzyme Enzyme
Rapidly decreasing sequence costs have enabled the rapid expansion Rapidly decreasing sequence costs have enabled the rapid expansion
Video: Glycolysis - Introduction to ATP and the burning of sugar

For a complete list of videos, visit our video library