This topic contains a solution. Click here to go to the answer

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 64 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly





 

Did you know?

Over time, chronic hepatitis B virus and hepatitis C virus infections can progress to advanced liver disease, liver failure, and hepatocellular carcinoma. Unlike other forms, more than 80% of hepatitis C infections become chronic and lead to liver disease. When combined with hepatitis B, hepatitis C now accounts for 75% percent of all cases of liver disease around the world. Liver failure caused by hepatitis C is now leading cause of liver transplants in the United States.

Did you know?

In most cases, kidneys can recover from almost complete loss of function, such as in acute kidney (renal) failure.

Did you know?

Patients should never assume they are being given the appropriate drugs. They should make sure they know which drugs are being prescribed, and always double-check that the drugs received match the prescription.

Did you know?

In Eastern Europe and Russia, interferon is administered intranasally in varied doses for the common cold and influenza. It is claimed that this treatment can lower the risk of infection by as much as 60–70%.

Did you know?

More than 50% of American adults have oral herpes, which is commonly known as "cold sores" or "fever blisters." The herpes virus can be active on the skin surface without showing any signs or causing any symptoms.

For a complete list of videos, visit our video library