This topic contains a solution. Click here to go to the answer

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 98 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly





 

Did you know?

Thyroid conditions cause a higher risk of fibromyalgia and chronic fatigue syndrome.

Did you know?

According to animal studies, the typical American diet is damaging to the liver and may result in allergies, low energy, digestive problems, and a lack of ability to detoxify harmful substances.

Did you know?

Only one in 10 cancer deaths is caused by the primary tumor. The vast majority of cancer mortality is caused by cells breaking away from the main tumor and metastasizing to other parts of the body, such as the brain, bones, or liver.

Did you know?

Walt Disney helped combat malaria by making an animated film in 1943 called The Winged Scourge. This short film starred the seven dwarfs and taught children that mosquitos transmit malaria, which is a very bad disease. It advocated the killing of mosquitos to stop the disease.

Did you know?

The highest suicide rate in the United States is among people ages 65 years and older. Almost 15% of people in this age group commit suicide every year.

For a complete list of videos, visit our video library