This topic contains a solution. Click here to go to the answer

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 113 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly





 

Did you know?

Inotropic therapy does not have a role in the treatment of most heart failure patients. These drugs can make patients feel and function better but usually do not lengthen the predicted length of their lives.

Did you know?

More than 150,000 Americans killed by cardiovascular disease are younger than the age of 65 years.

Did you know?

According to the American College of Allergy, Asthma & Immunology, more than 50 million Americans have some kind of food allergy. Food allergies affect between 4 and 6% of children, and 4% of adults, according to the CDC. The most common food allergies include shellfish, peanuts, walnuts, fish, eggs, milk, and soy.

Did you know?

The average older adult in the United States takes five prescription drugs per day. Half of these drugs contain a sedative. Alcohol should therefore be avoided by most senior citizens because of the dangerous interactions between alcohol and sedatives.

Did you know?

Women are two-thirds more likely than men to develop irritable bowel syndrome. This may be attributable to hormonal changes related to their menstrual cycles.

For a complete list of videos, visit our video library