This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 53 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

Earwax has antimicrobial properties that reduce the viability of bacteria and fungus in the human ear.

Did you know?

Anesthesia awareness is a potentially disturbing adverse effect wherein patients who have been paralyzed with muscle relaxants may awaken. They may be aware of their surroundings but unable to communicate or move. Neurologic monitoring equipment that helps to more closely check the patient's anesthesia stages is now available to avoid the occurrence of anesthesia awareness.

Did you know?

To combat osteoporosis, changes in lifestyle and diet are recommended. At-risk patients should include 1,200 to 1,500 mg of calcium daily either via dietary means or with supplements.

Did you know?

A headache when you wake up in the morning is indicative of sinusitis. Other symptoms of sinusitis can include fever, weakness, tiredness, a cough that may be more severe at night, and a runny nose or nasal congestion.

Did you know?

After 5 years of being diagnosed with rheumatoid arthritis, one every three patients will no longer be able to work.

The conduction system of the heart; traces the path of the electrical impulse that stimulates the he The conduction system of the heart; traces the path of the electrical impulse that stimulates the he
Two important changes occur in the upper airway in croup:The epiglottis swells, thereby occluding th Two important changes occur in the upper airway in croup:The epiglottis swells, thereby occluding th
Influence of enzyme-substrate affinity on the rate of an enzyme-catalyzed reaction. Influence of enzyme-substrate affinity on the rate of an enzyme-catalyzed reaction.
Restriction fragment-length polymorphisms showing different HaeIII genotypes in the b-fibrinogen ... Restriction fragment-length polymorphisms showing different HaeIII genotypes in the b-fibrinogen ...
Close-up of a newly created enzyme degrading PET plastic Close-up of a newly created enzyme degrading PET plastic
Cladogram Based On DNA Sequence Cladogram Based On DNA Sequence
Video: Fertilization and Development

For a complete list of videos, visit our video library