This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 110 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

As many as 20% of Americans have been infected by the fungus known as Histoplasmosis. While most people are asymptomatic or only have slight symptoms, infection can progress to a rapid and potentially fatal superinfection.

Did you know?

There are immediate benefits of chiropractic adjustments that are visible via magnetic resonance imaging (MRI). It shows that spinal manipulation therapy is effective in decreasing pain and increasing the gaps between the vertebrae, reducing pressure that leads to pain.

Did you know?

The heart is located in the center of the chest, with part of it tipped slightly so that it taps against the left side of the chest.

Did you know?

Increased intake of vitamin D has been shown to reduce fractures up to 25% in older people.

Did you know?

More than 20 million Americans cite use of marijuana within the past 30 days, according to the National Survey on Drug Use and Health (NSDUH). More than 8 million admit to using it almost every day.

Initial velocities of enzyme-catalyzed reactions Initial velocities of enzyme-catalyzed reactions
Post–Main-Sequence Evolution Post–Main-Sequence Evolution
Sequence of Physical Examination Procedure Sequence of Physical Examination Procedure
Enthalpic stabilization of the transition state in an enzyme-catalyzed reaction Enthalpic stabilization of the transition state in an enzyme-catalyzed reaction
DNA-sequence alignment of contigs on human chromosome 2 DNA-sequence alignment of contigs on human chromosome 2
Origin of replication sequence in E. coli Origin of replication sequence in E. coli
Video: Premenstrual Syndrome

For a complete list of videos, visit our video library