This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 63 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

Asthma attacks and symptoms usually get started by specific triggers (such as viruses, allergies, gases, and air particles). You should talk to your doctor about these triggers and find ways to avoid or get rid of them.

Did you know?

The largest baby ever born weighed more than 23 pounds but died just 11 hours after his birth in 1879. The largest surviving baby was born in October 2009 in Sumatra, Indonesia, and weighed an astounding 19.2 pounds at birth.

Did you know?

Most fungi that pathogenically affect humans live in soil. If a person is not healthy, has an open wound, or is immunocompromised, a fungal infection can be very aggressive.

Did you know?

People with high total cholesterol have about two times the risk for heart disease as people with ideal levels.

Did you know?

Medication errors are more common among seriously ill patients than with those with minor conditions.

Obtaining protein sequence information with tandem MS Obtaining protein sequence information with tandem MS
Exon recognition through cooperative binding of SR proteins and splicing factors Exon recognition through cooperative binding of SR proteins and splicing factors
Brain Activation During a Face Recognition Task Brain Activation During a Face Recognition Task
Enzyme block in phenylketonuria (PKU). Enzyme block in phenylketonuria (PKU).
Competitive enzyme immunoassay. (a) Shows the uninhibited reaction and (b) shows the inhibited ... Competitive enzyme immunoassay. (a) Shows the uninhibited reaction and (b) shows the inhibited ...
Rapidly decreasing sequence costs have enabled the rapid expansion Rapidly decreasing sequence costs have enabled the rapid expansion
Video: Uterine (menstrual) cycle - phases

For a complete list of videos, visit our video library