This topic contains a solution. Click here to go to the answer

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 109 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly





 

Did you know?

Bacteria have flourished on the earth for over three billion years. They were the first life forms on the planet.

Did you know?

Before a vaccine is licensed in the USA, the Food and Drug Administration (FDA) reviews it for safety and effectiveness. The CDC then reviews all studies again, as well as the American Academy of Pediatrics and the American Academy of Family Physicians. Every lot of vaccine is tested before administration to the public, and the FDA regularly inspects vaccine manufacturers' facilities.

Did you know?

Adolescents often feel clumsy during puberty because during this time of development, their hands and feet grow faster than their arms and legs do. The body is therefore out of proportion. One out of five adolescents actually experiences growing pains during this period.

Did you know?

It is difficult to obtain enough calcium without consuming milk or other dairy foods.

Did you know?

In the United States, an estimated 50 million unnecessary antibiotics are prescribed for viral respiratory infections.

For a complete list of videos, visit our video library