This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 111 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

On average, the stomach produces 2 L of hydrochloric acid per day.

Did you know?

Nearly all drugs pass into human breast milk. How often a drug is taken influences the amount of drug that will pass into the milk. Medications taken 30 to 60 minutes before breastfeeding are likely to be at peak blood levels when the baby is nursing.

Did you know?

According to the National Institute of Environmental Health Sciences, lung disease is the third leading killer in the United States, responsible for one in seven deaths. It is the leading cause of death among infants under the age of one year.

Did you know?

Patients who have been on total parenteral nutrition for more than a few days may need to have foods gradually reintroduced to give the digestive tract time to start working again.

Did you know?

The first documented use of surgical anesthesia in the United States was in Connecticut in 1844.

The steps of an enzyme-catalyzed reaction The steps of an enzyme-catalyzed reaction
Enzyme-linked receptors Enzyme-linked receptors
Brain Activation During a Face Recognition Task Brain Activation During a Face Recognition Task
Cell surface recognition factors Cell surface recognition factors
The steady state in enzyme kinetics The steady state in enzyme kinetics
Cladogram Based On DNA Sequence Cladogram Based On DNA Sequence
Video: Mechanisms of capillary exchange (transcytosis & bulk flow)

For a complete list of videos, visit our video library