This topic contains a solution. Click here to go to the answer

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 96 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly





 

Did you know?

The people with the highest levels of LDL are Mexican American males and non-Hispanic black females.

Did you know?

Prostaglandins were first isolated from human semen in Sweden in the 1930s. They were so named because the researcher thought that they came from the prostate gland. In fact, prostaglandins exist and are synthesized in almost every cell of the body.

Did you know?

According to the American College of Allergy, Asthma & Immunology, more than 50 million Americans have some kind of food allergy. Food allergies affect between 4 and 6% of children, and 4% of adults, according to the CDC. The most common food allergies include shellfish, peanuts, walnuts, fish, eggs, milk, and soy.

Did you know?

All adverse reactions are commonly charted in red ink in the patient's record and usually are noted on the front of the chart. Failure to follow correct documentation procedures may result in malpractice lawsuits.

Did you know?

Certain rare plants containing cyanide include apricot pits and a type of potato called cassava. Fortunately, only chronic or massive ingestion of any of these plants can lead to serious poisoning.

For a complete list of videos, visit our video library