This topic contains a solution. Click here to go to the answer

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 51 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly





 

Did you know?

Though “Krazy Glue” or “Super Glue” has the ability to seal small wounds, it is not recommended for this purpose since it contains many substances that should not enter the body through the skin, and may be harmful.

Did you know?

The horizontal fraction bar was introduced by the Arabs.

Did you know?

There are major differences in the metabolism of morphine and the illegal drug heroin. Morphine mostly produces its CNS effects through m-receptors, and at k- and d-receptors. Heroin has a slight affinity for opiate receptors. Most of its actions are due to metabolism to active metabolites (6-acetylmorphine, morphine, and morphine-6-glucuronide).

Did you know?

Human neurons are so small that they require a microscope in order to be seen. However, some neurons can be up to 3 feet long, such as those that extend from the spinal cord to the toes.

Did you know?

Throughout history, plants containing cardiac steroids have been used as heart drugs and as poisons (e.g., in arrows used in combat), emetics, and diuretics.

For a complete list of videos, visit our video library