This topic contains a solution. Click here to go to the answer

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 100 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly





 

Did you know?

Fatal fungal infections may be able to resist newer antifungal drugs. Globally, fungal infections are often fatal due to the lack of access to multiple antifungals, which may be required to be utilized in combination. Single antifungals may not be enough to stop a fungal infection from causing the death of a patient.

Did you know?

The most common treatment options for addiction include psychotherapy, support groups, and individual counseling.

Did you know?

The Centers for Disease Control and Prevention has released reports detailing the deaths of infants (younger than 1 year of age) who died after being given cold and cough medications. This underscores the importance of educating parents that children younger than 2 years of age should never be given over-the-counter cold and cough medications without consulting their physicians.

Did you know?

Bisphosphonates were first developed in the nineteenth century. They were first investigated for use in disorders of bone metabolism in the 1960s. They are now used clinically for the treatment of osteoporosis, Paget's disease, bone metastasis, multiple myeloma, and other conditions that feature bone fragility.

Did you know?

Although not all of the following muscle groups are commonly used, intramuscular injections may be given into the abdominals, biceps, calves, deltoids, gluteals, laterals, pectorals, quadriceps, trapezoids, and triceps.

For a complete list of videos, visit our video library