This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 108 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

The shortest mature adult human of whom there is independent evidence was Gul Mohammed in India. In 1990, he was measured in New Delhi and stood 22.5 inches tall.

Did you know?

Throughout history, plants containing cardiac steroids have been used as heart drugs and as poisons (e.g., in arrows used in combat), emetics, and diuretics.

Did you know?

When intravenous medications are involved in adverse drug events, their harmful effects may occur more rapidly, and be more severe than errors with oral medications. This is due to the direct administration into the bloodstream.

Did you know?

The average human gut is home to perhaps 500 to 1,000 different species of bacteria.

Did you know?

The U.S. Pharmacopeia Medication Errors Reporting Program states that approximately 50% of all medication errors involve insulin.

Determination of the complete genome sequence of Haemophilus influenzae by Venter, Smith, and collea Determination of the complete genome sequence of Haemophilus influenzae by Venter, Smith, and collea
Enzyme Inhibitors Enzyme Inhibitors
Activity, Food Restriction, and Weight Loss Activity, Food Restriction, and Weight Loss
Model of how direct repeats generated during the insertion of a transposon or an insertion sequence Model of how direct repeats generated during the insertion of a transposon or an insertion sequence
Constructing a restriction map (1 of 5) Constructing a restriction map (1 of 5)
phylogenetic results using the TCF7L2 transcripting mRNA sequence for the 4 listed taxa phylogenetic results using the TCF7L2 transcripting mRNA sequence for the 4 listed taxa
Video: Coronary Heart Disease Animation

For a complete list of videos, visit our video library