This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 62 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

There are more sensory neurons in the tongue than in any other part of the body.

Did you know?

If you use artificial sweeteners, such as cyclamates, your eyes may be more sensitive to light. Other factors that will make your eyes more sensitive to light include use of antibiotics, oral contraceptives, hypertension medications, diuretics, and antidiabetic medications.

Did you know?

More than 50% of American adults have oral herpes, which is commonly known as "cold sores" or "fever blisters." The herpes virus can be active on the skin surface without showing any signs or causing any symptoms.

Did you know?

Acetaminophen (Tylenol) in overdose can seriously damage the liver. It should never be taken by people who use alcohol heavily; it can result in severe liver damage and even a condition requiring a liver transplant.

Did you know?

Every flu season is different, and even healthy people can get extremely sick from the flu, as well as spread it to others. The flu season can begin as early as October and last as late as May. Every person over six months of age should get an annual flu vaccine. The vaccine cannot cause you to get influenza, but in some seasons, may not be completely able to prevent you from acquiring influenza due to changes in causative viruses. The viruses in the flu shot are killed—there is no way they can give you the flu. Minor side effects include soreness, redness, or swelling where the shot was given. It is possible to develop a slight fever, and body aches, but these are simply signs that the body is responding to the vaccine and making itself ready to fight off the influenza virus should you come in contact with it.

Enzyme activity is affected substantially by temperature Enzyme activity is affected substantially by temperature
Evolutionary tree derived from amino acid sequence comparisons Evolutionary tree derived from amino acid sequence comparisons
Structure of the enzyme chymotrypsin, a globular protein Structure of the enzyme chymotrypsin, a globular protein
Post–Main-Sequence Evolution of Low-Mass Stars Post–Main-Sequence Evolution of Low-Mass Stars
A glutamate carboxyl group in the enzyme deprotonates N-1 of the pyrimidine A glutamate carboxyl group in the enzyme deprotonates N-1 of the pyrimidine
Combination of arrangement and sequence is correct Combination of arrangement and sequence is correct
Video: Chemical Buffers - protein buffer, phosphate buffer system and bicarbonate buffer system

For a complete list of videos, visit our video library