This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 112 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

Coca-Cola originally used coca leaves and caffeine from the African kola nut. It was advertised as a therapeutic agent and "pickerupper." Eventually, its formulation was changed, and the coca leaves were removed because of the effects of regulation on cocaine-related products.

Did you know?

Acetaminophen (Tylenol) in overdose can seriously damage the liver. It should never be taken by people who use alcohol heavily; it can result in severe liver damage and even a condition requiring a liver transplant.

Did you know?

In inpatient settings, adverse drug events account for an estimated one in three of all hospital adverse events. They affect approximately 2 million hospital stays every year, and prolong hospital stays by between one and five days.

Did you know?

The training of an anesthesiologist typically requires four years of college, 4 years of medical school, 1 year of internship, and 3 years of residency.

Did you know?

Aspirin is the most widely used drug in the world. It has even been recognized as such by the Guinness Book of World Records.

Evolutionary tree derived from amino acid sequence comparisons Evolutionary tree derived from amino acid sequence comparisons
Complementary shapes of a substrate and its binding site on an enzyme Complementary shapes of a substrate and its binding site on an enzyme
Alternative pathway recognition and activation. C3w is on the surface of the microbe; factor B binds ... Alternative pathway recognition and activation. C3w is on the surface of the microbe; factor B binds ...
Restriction fragment-length polymorphisms showing different HaeIII genotypes in the b-fibrinogen ... Restriction fragment-length polymorphisms showing different HaeIII genotypes in the b-fibrinogen ...
Sequence Series Arithmatic Progression Problem Sequence Series Arithmatic Progression Problem
The Olestra study followed a sequence of steps The Olestra study followed a sequence of steps
Video: Allergic Rhinitis

For a complete list of videos, visit our video library