This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 52 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

Though “Krazy Glue” or “Super Glue” has the ability to seal small wounds, it is not recommended for this purpose since it contains many substances that should not enter the body through the skin, and may be harmful.

Did you know?

Once thought to have neurofibromatosis, Joseph Merrick (also known as "the elephant man") is now, in retrospect, thought by clinical experts to have had Proteus syndrome. This endocrine disease causes continued and abnormal growth of the bones, muscles, skin, and so on and can become completely debilitating with severe deformities occurring anywhere on the body.

Did you know?

Children with strabismus (crossed eyes) can be treated. They are not able to outgrow this condition on their own, but with help, it can be more easily corrected at a younger age. It is important for infants to have eye examinations as early as possible in their development and then another at age 2 years.

Did you know?

The first war in which wide-scale use of anesthetics occurred was the Civil War, and 80% of all wounds were in the extremities.

Did you know?

Many supplement containers do not even contain what their labels say. There are many documented reports of products containing much less, or more, that what is listed on their labels. They may also contain undisclosed prescription drugs and even contaminants.

Pre–Main-Sequence Stars Pre–Main-Sequence Stars
Competitive drug enzyme immunoassay. Competitive drug enzyme immunoassay.
Enzyme Enzyme
Genes are composed of a sequence of nucleotides in a DNA molecule Genes are composed of a sequence of nucleotides in a DNA molecule
The effect of frameshift mutations on a DNA sequence repeating the triplet sequence GAG The effect of frameshift mutations on a DNA sequence repeating the triplet sequence GAG
Cladogram Based On DNA Sequence Cladogram Based On DNA Sequence
Video: Proteins

For a complete list of videos, visit our video library