This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 114 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

Warfarin was developed as a consequence of the study of a strange bleeding disorder that suddenly occurred in cattle on the northern prairies of the United States in the early 1900s.

Did you know?

The toxic levels for lithium carbonate are close to the therapeutic levels. Signs of toxicity include fine hand tremor, polyuria, mild thirst, nausea, general discomfort, diarrhea, vomiting, drowsiness, muscular weakness, lack of coordination, ataxia, giddiness, tinnitus, and blurred vision.

Did you know?

Allergies play a major part in the health of children. The most prevalent childhood allergies are milk, egg, soy, wheat, peanuts, tree nuts, and seafood.

Did you know?

Approximately 15–25% of recognized pregnancies end in miscarriage. However, many miscarriages often occur before a woman even knows she is pregnant.

Did you know?

Fatal fungal infections may be able to resist newer antifungal drugs. Globally, fungal infections are often fatal due to the lack of access to multiple antifungals, which may be required to be utilized in combination. Single antifungals may not be enough to stop a fungal infection from causing the death of a patient.

Step 2 of gene cloning: The actions of a restriction enzyme and DNA ligase to produce a recombinant Step 2 of gene cloning: The actions of a restriction enzyme and DNA ligase to produce a recombinant
Enzyme Inhibitors Enzyme Inhibitors
Evolution of Stars Off the Main Sequence Evolution of Stars Off the Main Sequence
Competitive enzyme immunoassay. (a) Shows the uninhibited reaction and (b) shows the inhibited ... Competitive enzyme immunoassay. (a) Shows the uninhibited reaction and (b) shows the inhibited ...
Sequence Series Arithmatic Progression Problem Sequence Series Arithmatic Progression Problem
BLAST results showing a 280-base sequence of a chromosome 12 contig from rats BLAST results showing a 280-base sequence of a chromosome 12 contig from rats
Video: Dissociative Disorders (Part 2)

For a complete list of videos, visit our video library