This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 97 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

Liver spots have nothing whatsoever to do with the liver. They are a type of freckles commonly seen in older adults who have been out in the sun without sufficient sunscreen.

Did you know?

Signs and symptoms of a drug overdose include losing consciousness, fever or sweating, breathing problems, abnormal pulse, and changes in skin color.

Did you know?

If you could remove all of your skin, it would weigh up to 5 pounds.

Did you know?

Multiple sclerosis is a condition wherein the body's nervous system is weakened by an autoimmune reaction that attacks the myelin sheaths of neurons.

Did you know?

Cutaneous mucormycosis is a rare fungal infection that has been fatal in at least 29% of cases, and in as many as 83% of cases, depending on the patient's health prior to infection. It has occurred often after natural disasters such as tornados, and early treatment is essential.

Object and Word Recognition After Vertices Have Been Eliminated (Adapted from Szwed, M., Cohen, L, Q Object and Word Recognition After Vertices Have Been Eliminated (Adapted from Szwed, M., Cohen, L, Q
Competitive drug enzyme immunoassay. Competitive drug enzyme immunoassay.
Two models for enzyme–substrate interaction Two models for enzyme–substrate interaction
Effect of cooperative substrate binding on enzyme kinetics Effect of cooperative substrate binding on enzyme kinetics
A glutamate carboxyl group in the enzyme deprotonates N-1 of the pyrimidine A glutamate carboxyl group in the enzyme deprotonates N-1 of the pyrimidine
Model of how direct repeats generated during the insertion of a transposon or an insertion sequence Model of how direct repeats generated during the insertion of a transposon or an insertion sequence
Video: Autonomic Nervous System Animation

For a complete list of videos, visit our video library