This topic contains a solution. Click here to go to the answer

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 101 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly





 

Did you know?

This year, an estimated 1.4 million Americans will have a new or recurrent heart attack.

Did you know?

The most dangerous mercury compound, dimethyl mercury, is so toxic that even a few microliters spilled on the skin can cause death. Mercury has been shown to accumulate in higher amounts in the following types of fish than other types: swordfish, shark, mackerel, tilefish, crab, and tuna.

Did you know?

In inpatient settings, adverse drug events account for an estimated one in three of all hospital adverse events. They affect approximately 2 million hospital stays every year, and prolong hospital stays by between one and five days.

Did you know?

A headache when you wake up in the morning is indicative of sinusitis. Other symptoms of sinusitis can include fever, weakness, tiredness, a cough that may be more severe at night, and a runny nose or nasal congestion.

Did you know?

Lower drug doses for elderly patients should be used first, with titrations of the dose as tolerated to prevent unwanted drug-related pharmacodynamic effects.

For a complete list of videos, visit our video library