This topic contains a solution. Click here to go to the answer
« previous next »

Author Question: The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the ... (Read 76 times)

frankwu

  • Hero Member
  • *****
  • Posts: 549
on: Jul 15, 2019
The restriction enzyme SacI has a recognition sequence of GAGCT^C, where the caret (^) indicates the cut site. Examine the DNA molecule below.

AGAGCTCAGTCGAGAGCTCAGATCGATAGGAGCTCAGATCTCGATCACCTC
TCTCGAGTCAGCTCTCGAGTCTAGCTATCCTCGAGTCTAGAGCTAGTGGAG

How many separate molecules of DNA would you end up with if you treated the above DNA molecule with SacI?
◦ two
◦ three
◦ four
◦ five
Campbell Biology: Concepts & Connections ¦ Taylor, Simon, Dickey, Hogan, Reece ¦ 9th Edition
Buy Test-Bank


Related Topics

Need homework help now?

Ask unlimited questions for free

Ask a Question
Marked as best answer by frankwu on Jul 15, 2019

sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #1 on: Jul 15, 2019
Lorsum iprem. Lorsus sur ipci. Lorsem sur iprem. Lorsum sur ipdi, lorsem sur ipci. Lorsum sur iprium, valum sur ipci et, vala sur ipci. Lorsem sur ipci, lorsa sur iprem. Valus sur ipdi. Lorsus sur iprium nunc, valem sur iprium. Valem sur ipdi. Lorsa sur iprium. Lorsum sur iprium. Valem sur ipdi. Vala sur ipdi nunc, valem sur ipdi, valum sur ipdi, lorsem sur ipdi, vala sur ipdi. Valem sur iprem nunc, lorsa sur iprium. Valum sur ipdi et, lorsus sur ipci. Valem sur iprem. Valem sur ipci. Lorsa sur iprium. Lorsem sur ipci, valus sur iprem. Lorsem sur iprem nunc, valus sur iprium.
Answer Preview
Only 29% of students answer this correctly


frankwu

  • Hero Member
  • *****
  • Posts: 549
Reply #2 on: Jul 15, 2019
Thanks


sailorcrescent

  • Sr. Member
  • ****
  • Posts: 334
Reply #3 on: Jul 15, 2019
Welcome :)


« previous next »
 

Did you know?

In 1885, the Lloyd Manufacturing Company of Albany, New York, promoted and sold "Cocaine Toothache Drops" at 15 cents per bottle! In 1914, the Harrison Narcotic Act brought the sale and distribution of this drug under federal control.

Did you know?

Pubic lice (crabs) are usually spread through sexual contact. You cannot catch them by using a public toilet.

Did you know?

According to the Migraine Research Foundation, migraines are the third most prevalent illness in the world. Women are most affected (18%), followed by children of both sexes (10%), and men (6%).

Did you know?

Approximately 70% of expectant mothers report experiencing some symptoms of morning sickness during the first trimester of pregnancy.

Did you know?

Though the United States has largely rejected the metric system, it is used for currency, as in 100 pennies = 1 dollar. Previously, the British currency system was used, with measurements such as 12 pence to the shilling, and 20 shillings to the pound.

Transposon mutagenesis can be used to map a mutation in the genome sequence Transposon mutagenesis can be used to map a mutation in the genome sequence
The Enzyme Cycle The Enzyme Cycle
A signature sequence in the EF-1α/EF-Tu protein family A signature sequence in the EF-1α/EF-Tu protein family
Brain Activation During a Face Recognition Task Brain Activation During a Face Recognition Task
Analysis of a restriction fragment length Polymorphism Analysis of a restriction fragment length Polymorphism
Annotation of a DNA sequence containing part of the human beta-globin gene Annotation of a DNA sequence containing part of the human beta-globin gene
Video: B cells and antibodies

For a complete list of videos, visit our video library